In Common Sense, what advantages did Thomas Paine say the colonists had over the British in an armed conflict?
Refer to Copier maintenance Problem 1.20.
a. Divide the data into four bands according to the number of copiers serviced (X). Band 1 ranges from X = .5 to X = 2.5; band 2 ranges from X = 2.5 to X = 4.5; and so forth. Determine the median value of X and the median value of Y in each of the bands and develop the band smooth by connecting the four pairs of medians by straight lines on a scatter plot of the data. Does the band smooth suggest that the regression relation is linear? Discuss.
b. Obtain the 90 percent confidence band for the true regression line and plot it on the scatter plot prepared in part (a). Does the band smooth fall entirely inside the confidence band? What does this tell you about the appropriateness of the linear regression function?
c. Create a series of six overlapping neighborhoods of width 3.0 beginning at X = .5. The first neighborhood will range from X = .5 to X = 3.5; the second neighborhood will range from X = 1.5 to X = 4.5; and so on. For each of the six overlapping neighborhoods, fit a linear regression function and obtain the fitted value 
at the center Xc of the neighborhood. Develop a simplified version of the lowess smooth by connecting the six (Xc, Yc) pairs by straight lines on a scatter plot of the data. In what ways does your simplified lowness smooth differ from the band smooth obtained in part (a)?
Problem 1.20
Copier maintenance. The Tri-City Office Equipment Corporation sells an imported copier on a franchise basis and performs preventive maintenance and repair service on this copier. The data below have been collected from 45 recent calls on users to perform routine preventive maintenance service; for each call, X is the number of copiers serviced and Y is the total number of minutes spent by the service person. Assume that first-order regression model (1.1) is appropriate.
a. Obtain the estimated regression function.
b. Plot the estimated regression function and the data. How well does the estimated regression function fit the data?
c. Interpret bo in your estimated regression function. Does bo provide any relevant information here? Explain.
d. Obtain a point estimate of the mean service time when X = 5 copiers are serviced.
Assume a stock is selling for $40 with options available at 40, 45, and 50 strike prices. The 45 call option price is at $3. What is the intrinsic value of the 50 call? Is the 45 call in the money?
We are required to write summaries of each of the chapters of this book
The Culture Nature of Human Development. Each chapter summary should be between 150 and 250 words and include an overview of the chapter and the student’s reaction to the information.
………….Answer Preview………….
Chapter five addresses the issue of developmental transitions in individuals’ roles in their communities. The author starts by looking at age as a cultural metric for development and developmental transitions marking change in relation to the community. This chapter also focuses on the intersection of culture and the developmental phases and transitions in people’s lives. Developmental phases are marked by chronological….
158 words
Added to cart
Webster Global Services has debt at an after-tax rate of 1.6% and equity with a required return of 6.3%, given a Debt/Equity ratio of 1.4, calculate the Weighted Average Cost of Capital. There is no preferred stock.
Please answer with cited source (APA format) the below questions
Organizational structures are functional, divisional, matrix, team-based and virtual network.
1) Explain what types of quality management processes might be found in each of the organizational structures.
2) Describe what types of quality management processes might be found in each of the organizational structures.
I need this by 20:00hrs 8pm if not sooner!
Question 2.
Design PCR primers for the human MyD88gene. Be sure to list each primer from 5’ to 3’ and give the melting temperatures of each primer.
VERY IMPORTANT:Your primers should be designed so you can express MyD88 using the pcDNA6 expression vector which contains the sequence for a His-tag downstream of the MCS. You must clone the MyD88 PCR product into the KpnI site in such a way that the expressed protein will have a C-terminal His-tag. The KpnI recognition sequence is GGTACC and the cut site looks like this:
5’ GGTAC C 3’
3’ C CATGG 5’
MyD88 coding DNA:
atgcgacccgaccgcgctgaggctccaggaccgcccgccatggctgcag
gaggtcccggcgcggggtctgcggccccggtctcctccacatcctccct
tcccctggctgctctcaacatgcgagtgcggcgccgcctgtctctgttc
ttgaacgtgcggacacaggtggcggccgactggaccgcgctggcggagg
agatggactttgagtacttggagatccggcaactggagacacaagcgga
ccccactggcaggctgctggacgcctggcagggacgccctggcgcctct
gtaggccgactgctcgagctgcttaccaagctgggccgcgacgacgtgc
tgctggagctgggacccagcattgaggaggattgccaaaagtatatctt
gaagcagcagcaggaggaggctgagaagcctttacaggtggccgctgta
gacagcagtgtcccacggacagcagagctggcgggcatcaccacacttg
atgaccccctggggcatatgcctgagcgtttcgatgccttcatctgcta
ttgccccagcgacatccagtttgtgcaggagatgatccggcaactggaa
cagacaaactatcgactgaagttgtgtgtgtctgaccgcgatgtcctgc
ctggcacctgtgtctggtctattgctagtgagctcatcgaaaagaggtt
ggctagaaggccacggggtgggtgccgccggatggtggtggttgtctct
gatgattacctgcagagcaaggaatgtgacttccagaccaaatttgcac
tcagcctctctccaggtgcccatcagaagcgactgatccccatcaagta
caaggcaatgaagaaagagttccccagcatcctgaggttcatcactgtc
tgcgactacaccaacccctgcaccaaatcttggttctggactcgccttg
ccaaggccttgtccctgccctga
Forward Primer =
Tm =
Reverse Primer =
Tm =
How many amino acids are there in MyD88?
Refer to the sequence of the MCS of pcDNA6 shown below to design primers to clone the MyD88 gene into pcDNA6 using the BamHI and EcoRI sites ensuring that the expressed protein will be in frame with the His-tag.
Forward Primer =
Tm =
Reverse Primer =
Tm =
Assignment 6 Information Systems
The owners of XYZ Construction Inc. realize that they need to modernize their technology and information management systems within the company in order to make the organization more attractive for its IPO. Additionally, the owners see a value in using quantitative techniques to measure customer satisfaction, service quality, Equal Employment Opportunity (EEO) workforce compliance, and new market evaluation. Specifically, the company owners want you to describe and analyze the steps needed to plan, implement, evaluate, and control new technology that will enable them transform from a privately-held regional company to a publicly-owned international company. Activity Resources:
• Review Chapter 14 in the SKS 7000?Executive Concepts in Business Strategy textbook.
• B?langer, F., & Crossler, R. E. (2011). (Please see attachment)
• Buhl, H. U., M?ller, G., Fridgen, G., & R?glinger, M. (2012). (Please see attachment)
• Petter, S., DeLone, W., & McLean, E. R. (2012). (Please see attachment) Main Task: Description of an Information System
Your requirement is to develop a PowerPoint presentation to describe and analyze the aforementioned topics identified by the owners of XYZ Construction, Inc. Within the presentation, you must describe and analyze the following information management and quantitative techniques/statistics relative to this horizontal construction company: 1. Planning for Technology
2. Implementing a Technology System or Change
3. Technology Evaluation and Control
In addition to the textbook material for this course (properly cited within the paper), you must also use at least five (5) peer reviewed journal articles. Incorporate appropriate animations, transitions, and graphics as well as ?speaker notes? for each slide. The speaker notes may be comprised of brief paragraphs or bulleted lists. Length: 10-12 slides (with a separate reference slide) Notes Length: 200-350 words for each slide Be sure to include citations for quotations and paraphrases with references in APA format and style. Save the file as PPT with the correct course code information. Upload the completed assignment in the Activities area of the course.
Submit an essay of 300 words or less that addresses these questions: • How will this scholarship affect your life and nursing career aspirations? • How will you use the knowledge you acquire to impact future patients and the nursing profession?
Attachments:
We are a leading academic writing company, which has been providing exclusive writing services for years.
With an exceptional team of professional academic experts in a wide range of subjects, we guarantee high-quality custom-written papers.
Hi there! Click one of our representatives below and we will get back to you as soon as possible.
CONWAY-schola….docx